Getting Started
ssw-py is designed to be simple to install and use.
Motivation
ssw-py exists to help oligo alignment in python. The upstream SSW Library is quality cross-platform solution to use as the foundation of this tool.
Requirements
ssw-py is built and tested on MacOS, Linux and Windows 64-bit systems; we do not provide official Windows support. Python versions 3.8 - 3.11 builds are supported.
Wheels are released for CPython versions following the EOL model.
Installation
If you want to install the latest stable build of ssw-py, you can
install it using pip:
$ pip install ssw-py
NOTE: We support wheel builds for PyPi for the 3 most recent CPython versions. Target platforms for wheels are MacOS x86-64 arm64, Linux x86-64, and Windows x86-64.
If your Python version and platform fall outside this such as Linux aarch64 it is confirmed ssw-py builds on this platform but it is not supported as our build GitHub actions runners do not run these builds expediently.
Alignment
The ssw module includes support for doing alignments of a “read”
sequence to a “reference” sequence. Users can choose to make these two values
Python strings or Python bytes-strings as the ssw.alignmentmgr.AlignmentMgr supports
both data types for its class attributes and methods.
Workflow
The easiest way to run the code is below:
from ssw import AlignmentMgr
# Reference sequence
ref_seq = 'CAGCCTTTCTGACCCGGAAATCAAAATAGGCACAACAAA'
# Read sequence
read_seq = 'CTGAGCCGGTAAATC'
# Set the AlignmentMgr instance to run one or
# more alignment computations with by specifying a match score or
align_mgr = AlignmentMgr(
match_score=2,
mismatch_penalty=2,
)
align_mgr.set_read(read_seq)
align_mgr.set_reference(ref_seq)
# Compute the alignment
alignment = align_mgr.align(
gap_open=3,
gap_extension=1,
)
# Print the Alignment tuple
print(alignment)
# Print a formated result
align_mgr.print_result(alignment)
For more detailed exampls refer to examples/blast.py and test/test_ssw.py
Advanced Installation
Users interested in contributing to development may want to work with the latest development build. To get the latest and greatest code, head over our Github repo and clone the repo or download a tarball. Building from source is easy.
If you don’t install the latest build via pip or conda, you might have to install
Cython, prior to running the setup.py script:
$ pip install Cython
Or via conda:
$ conda install Cython
Then run:
$ python setup.py install
or if you are developing ssw-py enhancements:
$ python setup.py build_ext --inplace
We recommend running setup.py with either build_ext --inplace or
develop rather than install if you are testing development builds.
build_ext --inplace will build the Cython and C API extensions in the
package directory without copying any files to your local environment
site-packages directory (so you can import and run tests from within the
package) and develop will build in place and then put symlinks in your
site packages directory.
Testing
Every commit pushed to the ssw-py GitHub repo is tested to ensure it builds properly and passes our unit testing framework as a GitHub action
If you’d like to run the tests yourself, we suggest the following workflow:
$ git clone https://github.com/libnano/ssw-py
$ cd ssw-py
$ python setup.py build_ext --inplace
$ pytest
NOTE: pip / conda install pytest if not in your environment
Contributing
Contributions are welcomed via pull requests.
Contributions that improve the stability, compatibility or test coverage are best way to interface with the project and dev team. Feature requests via GitHub issues are also welcome.
Contact the ssw-py maintainers prior to beginning your work to make sure it makes sense for the project.
By contributing, you also agree to release your code under the MIT License
After a successful PR will be listed under the contributors.
Forking
A forking workflow is preferred for all pull requests.
Branch naming
Branch naming is preferred to use the format:
<GitHub user-name>-<short keyword description of change>
Keep branch names not too long. A good example would be for the user grinner
for a documentation update for the 1.0.0 staging branch:
$ git checkout -b grinner-docs-update-1.0.0-pass-01
With the trailing 01 indicative of it being part of several potential
Another example pass that focuses on code clarity comments would be:
$ git checkout -b grinner-code-clarity-and-comments
Development
Development requires the use of C Python 3.8+, pytest and
pre-commit as they are used to build and run ssw-py
code CI in the GitHub Action.
Install these dependencies in your python development environment
(virtualenv, conda, etc):
$ pip install cython pre-commit pytest
# or
$ conda install cython pre-commit pytest
Install pre-commit in repo the with:
$ pre-commit install
To ensure the git hook is excecuted on every commit.
Pull Requests
Pull Requests should meet the following requirements:
Excellent PR description describing all changes made. Please use markdown syntax highlighting to help readability.
If change is code related, have test coverage for the changes implemented.
Attempt to make the PR 1 commit only. Multiple are OK if it helps illustrate the change better.
Commit messages should describe the changes.
Provided you contact the maintainers in advance, theu will code review your PR, provide feedback and squash merge your code on approval.
TIP: Interactive rebase is helpful to fix old commit messages.
For example, run:
$ git rebase -i HEAD~2
To rebase the last 2 commits. Use s to mark the most recent commit(s), save, then
modify the collective commit messages to update poor commit messages.