Getting Started

Primer3-py is designed to be simple to install and use.

Requirements

Primer3-py is built and tested on MacOS, Linux and Windows 64-bit systems; we do not provide official Windows support. Python versions 3.8 - 3.13 builds are supported.

Wheels are released for CPython versions following the EOL model. Pre-built wheels are available for:

  • MacOS (x86-64, arm64)

  • Linux (x86-64)

  • Windows (x86-64)

For other platforms (e.g., Linux aarch64), the package can be built from source but is not officially supported.

Installation

Standard Installation

To install the latest stable version:

$ pip install primer3-py

Development Installation

For development or to work with the latest code:

  1. Clone the repository:

    $ git clone https://github.com/libnano/primer3-py
$ cd primer3-py

  2. Install in development mode with dev dependencies:

    $ pip install -e ".[dev]"

Windows-Specific Setup

If building on Windows, you’ll need the TDM-GCC MinGW Compiler:

  1. Download and install from TDM-GCC MinGW

  2. Ensure the compiler is in your system PATH

  3. Use the installation commands above

Thermodynamic analysis

The thermodynamic primer3.bindings include support for Tm, homodimer, heterodimer, hairpin, and 3’ end stability calculations:

All of these low-level thermodynamic functions share a set of keyword arguments used to define the parameters of the respective calculation:

For all low-level calculations:
mv_conc (float/int)

Monovalent cation concentration (mM)

dv_conc (float/int)

Divalent cation concentration (mM)

dntp_conc (float/int)

dNTP concentration (mM)

dna_conc (float/int)

DNA concentration (nM)

For homodimer/heterodimer/end stabilty calculation:
temp_c (int)

Simulation temperature for dG calcs (C)

max_loop (int)

Maximum size of loops in the structure

For Tm calculations:
dmso_conc (float)

Concentration of DMSO (%)

dmso_fact (float)

DMSO correction factor

formamide_conc (float)

Concentration of formamide (mol/l)

annealing_temp_c (float)

Actual annealing temperature of the PCR reaction

max_nn_length (int)

Maximum length for nearest-neighbor calcs

tm_method (str)

Tm calculation method (breslauer or santalucia)

salt_corrections_method

Salt correction method (schildkraut, wczarzy, santalucia)

For finer grain control of analysis, use primer3.thermoanalysis. NOTE. camelCase methods are deprecated. Please write all new code with primer3.thermoanalysis.ThermoAnalysis snake case methods

Primer design

Primer3-py includes bindings for the Primer3 primer design pipeline. The parameters for the design process are provided as Python dictionaries that mirror the BoulderIO input files required by the Primer3 binaries. There are numerous examples of how to use the pipeline in the tests/ directory.

For documentation regarding the input and output parameters of the pipeline, please see the Primer3 2.6.1 documentation (the underlying library for this package is a derivative of v2.6.1).

It is worth noting that some of the inputs deviate from the string format described in the Primer3 documentation, with notable exceptions being related to index lists and ranges (i.e., ranges are typically provided as lists/tuples, and lists of ranges as lists of lists or tuples of tuples). Here we highlight the differences between the typical SEQUENCE_PRIMER_PAIR_OK_REGION_LIST input and the Python binding input:

Primer3 BoulderIO input:      100,50,300,50 ; 900,60,,
Primer3-py Python input:      [[100,50,300,50], [900,60,-1,-1]]

Similarly, PRIMER_PRODUCT_SIZE_RANGE is provided in the following forms:

Primer3 BoulderIO input:      75-100 100-125 125-150
Primer3-py Python input:      [[75,100],[100,125],[125,150]]

Workflow

The easiest way to run the primer design pipeline is with primer3.bindings.design_primers(). Notice that Primer3 parameters prefixed with “SEQUENCE_” are provided in a separate dictionary from those prefixed with “PRIMER_”. For more advanced / modular approaches, see the Primary analysis and design API documentation.

Example usage:

bindings.design_primers(
    seq_args={
        'SEQUENCE_ID': 'MH1000',
        'SEQUENCE_TEMPLATE': (
            'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTACATTTT'
            'AGCATCAGTGAGTACAGCATGCTTACTGGAAGAGAGGGTCATGCA'
            'ACAGATTAGGAGGTAAGTTTGCAAAGGCAGGCTAAGGAGGAGACG'
            'CACTGAATGCCATGGTAAGAACTCTGGACATAAAAATATTGGAAG'
            'TTGTTGAGCAAGTNAAAAAAATGTTTGGAAGTGTTACTTTAGCAA'
            'TGGCAAGAATGATAGTATGGAATAGATTGGCAGAATGAAGGCAAA'
            'ATGATTAGACATATTGCATTAAGGTAAAAAATGATAACTGAAGAA'
            'TTATGTGCCACACTTATTAATAAGAAAGAATATGTGAACCTTGCA'
            'GATGTTTCCCTCTAGTAG',
        ),
        'SEQUENCE_INCLUDED_REGION': [36,342]
    },
    global_args={
        'PRIMER_OPT_SIZE': 20,
        'PRIMER_PICK_INTERNAL_OLIGO': 1,
        'PRIMER_INTERNAL_MAX_SELF_END': 8,
        'PRIMER_MIN_SIZE': 18,
        'PRIMER_MAX_SIZE': 25,
        'PRIMER_OPT_TM': 60.0,
        'PRIMER_MIN_TM': 57.0,
        'PRIMER_MAX_TM': 63.0,
        'PRIMER_MIN_GC': 20.0,
        'PRIMER_MAX_GC': 80.0,
        'PRIMER_MAX_POLY_X': 100,
        'PRIMER_INTERNAL_MAX_POLY_X': 100,
        'PRIMER_SALT_MONOVALENT': 50.0,
        'PRIMER_DNA_CONC': 50.0,
        'PRIMER_MAX_NS_ACCEPTED': 0,
        'PRIMER_MAX_SELF_ANY': 12,
        'PRIMER_MAX_SELF_END': 8,
        'PRIMER_PAIR_MAX_COMPL_ANY': 12,
        'PRIMER_PAIR_MAX_COMPL_END': 8,
        'PRIMER_PRODUCT_SIZE_RANGE': [
            [75,100], [100,125], [125,150],
            [150,175], [175,200], [200,225]
        ],
    })

Advanced Installation

Users interested in contributing to development may want to work with the latest development build. To get the latest and greatest code, head over to our Github repo and clone the repo or download a tarball. Building from source is easy:

# For regular installation from source
$ pip install .

# For development installation (recommended)
$ pip install -e .

We recommend using the development installation (-e flag) if you are testing or developing primer3-py enhancements. This creates an “editable” installation that links to your source code, allowing you to modify the code without reinstalling.

NOTE: If you’re attempting to build on Windows, please review the primer3 documentation regarding environment requirements. You’ll need to install the latest version of the TDM-GCC MinGW Compiler if building in a MinGW / Mingw-w64 environment: TDM-GCC MinGW Compiler

Testing

Every commit pushed to the primer3-py GitHub repo is tested via GitHub Actions to ensure it builds properly and passes our unit tests.

If you’d like to run the tests yourself:

# Clone the repository
$ git clone https://github.com/libnano/primer3-py
$ cd primer3-py

# Create and activate a virtual environment
$ python -m venv p3p-test-env

# On Unix/macOS:
$ source p3p-test-env/bin/activate

# On Windows (run this instead of the source command above):
# p3p-test-env\Scripts\activate

# Install development dependencies and the package in editable mode
$ pip install -e ".[dev]"

# Run tests from the package directory
$ pytest

# When finished, deactivate the virtual environment
$ deactivate

Using a virtual environment is recommended to ensure a clean, isolated development environment and avoid conflicts with other Python packages in your system.

Contributing

Contributions are welcomed via pull requests. Contact the primer3-py maintainers prior to beginning your work to make sure it makes sense for the project.

By contributing, you also agree to release your code under the GPLv2.

For detailed contribution guidelines, development setup, workflows, and release process, see our Development Guide.