Getting Started 

Primer3-py is designed to be simple to install and use.

Requirements 

Primer3-py is built and tested on MacOS, Linux and Windows 64-bit systems; we do not provide official Windows support. Python versions 3.8 - 3.12 builds are supported.

Wheels are released for CPython versions following the EOL model.

Installation 

If you want to install the latest stable build of Primer3-py, you can install it using pip:

$ pip install primer3-py

NOTE: We support wheel builds for PyPi for the 3 most recent CPython versions. Target platforms for wheels are MacOS x86-64 arm64, Linux x86-64, and Windows x86-64.

If your Python version and platform fall outside this such as Linux aarch64 it is confirmed primer3-py builds on this platform but it is not supported as our build GitHub actions runners do not run these builds expediently.

Thermodynamic analysis 

The thermodynamic primer3.bindings include support for Tm, homodimer, heterodimer, hairpin, and 3’ end stability calculations:

All of these low-level thermodynamic functions share a set of keyword arguments used to define the parameters of the respective calculation:

For all low-level calculations:

mv_conc (float/int)
Monovalent cation concentration (mM)

dv_conc (float/int)
Divalent cation concentration (mM)

dntp_conc (float/int)
dNTP concentration (mM)

dna_conc (float/int)
DNA concentration (nM)

For homodimer/heterodimer/end stabilty calculation:

temp_c (int)
Simulation temperature for dG calcs (C)

max_loop (int)
Maximum size of loops in the structure

For Tm calculations:

dmso_conc (float)
Concentration of DMSO (%)

dmso_fact (float)
DMSO correction factor

formamide_conc (float)
Concentration of formamide (mol/l)

annealing_temp_c (float)
Actual annealing temperature of the PCR reaction

max_nn_length (int)
Maximum length for nearest-neighbor calcs

tm_method (str)
Tm calculation method (breslauer or santalucia)

salt_corrections_method
Salt correction method (schildkraut, wczarzy, santalucia)

For finer grain control of analysis, use primer3.thermoanalysis. NOTE. camelCase methods are deprecated. Please write all new code with primer3.thermoanalysis.ThermoAnalysis snake case methods

Primer design 

Primer3-py includes bindings for the Primer3 primer design pipeline. The parameters for the design process are provided as Python dictionaries that mirror the BoulderIO input files required by the Primer3 binaries. There are numerous examples of how to use the pipeline in the tests/ directory.

For documentation regarding the input and output parameters of the pipeline, please see the Primer3 2.6.1 documentation (the underlying library for this package is a derivative of v2.6.1).

It is worth noting that some of the inputs deviate from the string format described in the Primer3 documentation, with notable exceptions being related to index lists and ranges (i.e., ranges are typically provided as lists/tuples, and lists of ranges as lists of lists or tuples of tuples). Here we highlight the differences between the typical SEQUENCE_PRIMER_PAIR_OK_REGION_LIST input and the Python binding input:

Primer3 BoulderIO input:      100,50,300,50 ; 900,60,,
Primer3-py Python input:      [[100,50,300,50], [900,60,-1,-1]]

Similarly, PRIMER_PRODUCT_SIZE_RANGE is provided in the following forms:

Primer3 BoulderIO input:      75-100 100-125 125-150
Primer3-py Python input:      [[75,100],[100,125],[125,150]]

Workflow 

The easiest way to run the primer design pipeline is with primer3.bindings.design_primers(). Notice that Primer3 parameters prefixed with “SEQUENCE_” are provided in a separate dictionary from those prefixed with “PRIMER_”. For more advanced / modular approaches, see the Primary analysis and design API documentation.

Example usage:

bindings.design_primers(
    seq_args={
        'SEQUENCE_ID': 'MH1000',
        'SEQUENCE_TEMPLATE': 'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTACATTTT'
                             'AGCATCAGTGAGTACAGCATGCTTACTGGAAGAGAGGGTCATGCA'
                             'ACAGATTAGGAGGTAAGTTTGCAAAGGCAGGCTAAGGAGGAGACG'
                             'CACTGAATGCCATGGTAAGAACTCTGGACATAAAAATATTGGAAG'
                             'TTGTTGAGCAAGTNAAAAAAATGTTTGGAAGTGTTACTTTAGCAA'
                             'TGGCAAGAATGATAGTATGGAATAGATTGGCAGAATGAAGGCAAA'
                             'ATGATTAGACATATTGCATTAAGGTAAAAAATGATAACTGAAGAA'
                             'TTATGTGCCACACTTATTAATAAGAAAGAATATGTGAACCTTGCA'
                             'GATGTTTCCCTCTAGTAG',
        'SEQUENCE_INCLUDED_REGION': [36,342]
    },
    global_args={
        'PRIMER_OPT_SIZE': 20,
        'PRIMER_PICK_INTERNAL_OLIGO': 1,
        'PRIMER_INTERNAL_MAX_SELF_END': 8,
        'PRIMER_MIN_SIZE': 18,
        'PRIMER_MAX_SIZE': 25,
        'PRIMER_OPT_TM': 60.0,
        'PRIMER_MIN_TM': 57.0,
        'PRIMER_MAX_TM': 63.0,
        'PRIMER_MIN_GC': 20.0,
        'PRIMER_MAX_GC': 80.0,
        'PRIMER_MAX_POLY_X': 100,
        'PRIMER_INTERNAL_MAX_POLY_X': 100,
        'PRIMER_SALT_MONOVALENT': 50.0,
        'PRIMER_DNA_CONC': 50.0,
        'PRIMER_MAX_NS_ACCEPTED': 0,
        'PRIMER_MAX_SELF_ANY': 12,
        'PRIMER_MAX_SELF_END': 8,
        'PRIMER_PAIR_MAX_COMPL_ANY': 12,
        'PRIMER_PAIR_MAX_COMPL_END': 8,
        'PRIMER_PRODUCT_SIZE_RANGE': [
            [75,100],[100,125],[125,150],
            [150,175],[175,200],[200,225]
        ],
    })

Advanced Installation 

Users interested in contributing to development may want to work with the latest development build. To get the latest and greatest code, head over our Github repo and clone the repo or download a tarball. Building from source is easy.

If you don’t install the latest build via pip or conda, you might have to install Cython, prior to running the setup.py script:

$ pip install Cython

Or via conda:

$ conda install Cython

Then run:

$ python setup.py install

or if you are developing primer3-py enhancements:

$ python setup.py build_ext --inplace

We recommend running setup.py with either build_ext --inplace or develop rather than install if you are testing development builds. build_ext --inplace will build the Cython and C API extensions in the package directory without copying any files to your local environment site-packages directory (so you can import and run tests from within the package) and develop will build in place and then put symlinks in your site packages directory (this will allow Primer3-py)

NOTE: If you’re attempting to build on Windows, please review the primer3 documentation regarding environment requirements. You’ll need to install the latest version of the TDM-GCC MinGW Compiler if building in a MinGW / Mingw-w64 environment: TDM-GCC MinGW Compiler

Testing 

Every commit pushed to the primer3-py GitHub repo is tested to ensure it builds properly and passes our unit testing framework as a GitHub action

If you’d like to run the tests yourself, we suggest the following workflow:

$ git clone https://github.com/libnano/primer3-py
$ cd primer3-py
$ python setup.py build_ext --inplace
$ pytest

NOTE: pip / conda install pytest if not in your environment

Contributing 

Contributions are welcomed via pull requests.

Contact the primer3-py maintainers prior to beginning your work to make sure it makes sense for the project.

By contributing, you also agree to release your code under the GPLv2

After a successful PR will be listed under the contributors.

Forking 

A forking workflow is preferred for all pull requests.

Branch naming 

Branch naming is preferred to use the format:

<GitHub user-name>-<short keyword description of change>

Keep branch names not too long. A good example would be for the user grinner for a documentation update for the 1.0.0 staging branch:

$ git checkout -b grinner-docs-update-1.0.0-pass-01

With the trailing 01 indicative of it being part of several potential

Another example pass that focuses on code clarity comments would be:

$ git checkout -b grinner-code-clarity-and-comments

Development 

Development requires the use of C Python 3.8+, pytest and pre-commit as they are used to build and run primer3-py code CI in the GitHub Action.

Install these dependencies in your python development environment (virtualenv, conda, etc):

$ pip install cython pre-commit pytest
# or
$ conda install cython pre-commit pytest

Install pre-commit in repo the with:

$ pre-commit install

To ensure the git hook is excecuted on every commit.

Pull Requests 

Pull Requests should meet the following requirements:

Excellent PR description describing all changes made. Please use markdown syntax highlighting to help readability.
If change is code related, have test coverage for the changes implemented.
Attempt to make the PR 1 commit only. Multiple are OK if it helps illustrate the change better.
Commit messages should describe the changes.
Provided you contact the maintainers in advance, theu will code review your PR, provide feedback and squash merge your code on approval.

TIP: Interactive rebase is helpful to fix old commit messages. For example, run:

$ git rebase -i HEAD~2

To rebase the last 2 commits. Use s to mark the most recent commit(s), save, then modify the collective commit messages to update poor commit messages.