Low-level thermodynamic analysis
primer3.thermoanalysis
Contains Cython functions and classes that enable repeated thermodynamic calculations using common calculation parameters.
The parameters included in this module map to the ntthal binary (thal.c/h source) in the primer3 library and ARE NOT covered in the primer design documentation provided with primer3. Please see class and method docstrings in primer3-py for parameter explanations.
Calculations are performed under the following paradigm:
Instantiate
ThermoAnalysisobject with appropriate parameters
oligo_calc = ThermoAnalysis(mv_conc=50, dv_conc=0.2)
Use the object instance for subsequent calculations
for primer in primer_list:
print(oligo_calc.calc_tm(primer)) # Print the melting temp
(optional) You can update an individual parameter at any time
oligo_calc.mv_conc = 80 # Increase the monovalent ion conc to 80 mM
- class primer3.thermoanalysis.ThermoAnalysis
Subclass of
_ThermoAnalysisto enable singleton behaviorAs of v1.2.0 no longer a
Singletonas thread-safety exists- calcEndStability(seq1, seq2)
Deprecated since version 1.0.0.: Choose
calc_end_stability()insteadCalculate the 3’ end stability of DNA sequence
seq1against DNA sequenceseq2- Parameters:
seq1 (
Union[str,bytes]) – sequence string 1seq2 (
Union[str,bytes]) – sequence string 2
- Returns:
class`ThermoResult`
- Return type:
Computed end stability
- calcHairpin(seq1, output_structure=False)
Deprecated since version 1.0.0.: Choose
calc_hairpin()insteadCalculate the hairpin formation thermodynamics of a DNA sequence,
seq1- Parameters:
seq1 (
Union[str,bytes]) – (str | bytes) sequence string 1output_structure (
bool) – IfTrue, build output structure.
- Return type:
- Returns:
Computed hairpin
ThermoResult
- calcHeterodimer(seq1, seq2, output_structure=False)
Deprecated since version 1.0.0.: Choose
calc_heterodimer()insteadCalculate the heterodimer formation thermodynamics of two DNA sequences,
seq1andseq2- Parameters:
seq1 (
Union[str,bytes]) – (str | bytes) sequence string 1seq2 (
Union[str,bytes]) – (str | bytes) sequence string 2output_structure (
bool) – IfTrue, build output structure.
- Returns:
class`ThermoResult`
- Return type:
Computed heterodimer
- calcHomodimer(seq1, output_structure=False)
Deprecated since version 1.0.0.: Choose
calc_homodimer()insteadCalculate the homodimer formation thermodynamics of a DNA sequence,
seq1- Parameters:
seq1 (
Union[str,bytes]) – (str | bytes) sequence string 1output_structure (
bool) – IfTrue, build output structure.
- Return type:
- Returns:
Computed homodimer
ThermoResult
- calcTm(seq1)
Deprecated since version 1.0.0.: Choose
calc_tm()insteadCalculate the melting temperature (Tm) of a DNA sequence (deg. C).
- Parameters:
seq1 (
Union[str,bytes]) – (str | bytes) sequence string 1- Return type:
float- Returns:
floating point Tm result
- Raises:
ValueError – If sequence contains non-ACGT bases
- calc_end_stability(seq1, seq2)
Calculate the 3’ end stability of DNA sequence seq1 against DNA sequence seq2
- Parameters:
seq1 – sequence string 1
seq2 – sequence string 2
- Return type:
- Returns:
Computed end stability
ThermoResult
- calc_hairpin(seq1, output_structure=False)
Calculate the hairpin formation thermodynamics of a DNA sequence,
seq1- Parameters:
seq1 – (str | bytes) sequence string 1
output_structure – If True, build output structure.
- Returns:
Computed hairpin
ThermoResult
- calc_heterodimer(seq1, seq2, output_structure=False)
Calculate the heterodimer formation thermodynamics of two DNA sequences,
seq1andseq2- Parameters:
seq1 – (str | bytes) sequence string 1
seq2 – (str | bytes) sequence string 2
output_structure – If True, build output structure.
- Returns:
Computed heterodimer
ThermoResult
- calc_homodimer(seq1, output_structure=False)
Calculate the homodimer formation thermodynamics of a DNA sequence,
seq1- Parameters:
seq1 – (str | bytes) sequence string 1
output_structure – If True, build output structure.
- Returns:
Computed homodimer
ThermoResult
- calc_tm(seq1)
Calculate the melting temperature (Tm) of a DNA sequence (deg. C).
- Parameters:
seq1 – (str | bytes) sequence string 1
- Return type:
float- Returns:
floating point Tm result
- Raises:
ValueError – If sequence contains non-ACGT bases
- dna_conc
Concentration of DNA oligos (nM)
- dntp_conc
Concentration of dNTPs (mM)
- dv_conc
Concentration of divalent cations (mM)
- max_loop
Maximum hairpin loop size (bp)
- mispriming_check(putative_seq, sequences, tm_threshold)
Calculate the heterodimer formation thermodynamics of a DNA sequence,
putative_seqwith a list of sequences relative to a melting temperature threshold- Parameters:
putative_seq – (str | bytes) sequence to check
sequences – (Iterable[str | bytes]) Iterable of sequence strings to check against
tm_threshold – melting temperature threshold
- Returns:
- Tuple[bool, int, float] of form::
is_offtarget (bool), max_offtarget_seq_idx (int), max_offtarget_tm (double)
- mv_conc
Concentration of monovalent cations (mM)
- run_design(global_args, seq_args, misprime_lib=None, mishyb_lib=None)
Wraps the primer design functionality of Primer3.
Added in version 2.0.0: List versions of PRIMER_{PAIR, LEFT, RIGHT, INTERNAL} are added to the design output dictionary keys as a convenience. Original per item PRIMER_ keys are retained as well for compatibility.
- Parameters:
seq_args (
Optional[Dict[str,Any]]) – Primer3 sequence/design args as per Primer3 docsglobal_args (
Dict[str,Any]) – Primer3 global args as per Primer3 docsmisprime_lib (
Optional[Dict[str,Any]]) – Sequence name: sequence dictionary for mispriming checks.mishyb_lib (
Optional[Dict[str,Any]]) – Sequence name: sequence dictionary for mishybridization checks.
- Return type:
Dict[str,Any]- Returns:
primer3 key value results dictionary
- salt_correction_method
Method used for salt corrections applied to melting temperature calculations. May be provided as a string (see
salt_correction_methods_dict) or the respective integer representation.
- set_thermo_args(mv_conc=50.0, dv_conc=1.5, dntp_conc=0.6, dna_conc=50.0, dmso_conc=0.0, dmso_fact=0.6, formamide_conc=0.0, annealing_temp_c=-10.0, temp_c=37.0, max_nn_length=60, max_loop=30, tm_method='santalucia', salt_corrections_method='santalucia', **kwargs)
Set parameters in global
_ThermoAnalysisinstance- Parameters:
mv_conc (
Union[float,int]) – Monovalent cation conc. (mM)dv_conc (
Union[float,int]) – Divalent cation conc. (mM)dntp_conc (
Union[float,int]) – dNTP conc. (mM)dna_conc (
Union[float,int]) – DNA conc. (nM)dmso_conc (
float) – Concentration of DMSO (%)dmso_fact (
float) – DMSO correction factor, default 0.6formamide_conc (
float) – Concentration of formamide (mol/l)annealing_temp_c (
float) – Actual annealing temperature of the PCR reaction in (C)temp_c (
Union[float,int]) – Simulation temperature for dG (Celsius)max_nn_length (
int) – Maximum length for nearest-neighbor calcstm_method (
str) – Tm calculation method (breslauer or santalucia)salt_corrections_method (
str) – Salt correction method (schildkraut, owczarzy, santalucia)
- temp_c
Simulation temperature (deg. C)
- tm_method
Method used to calculate melting temperatures. May be provided as a string (see
tm_methods_dict) or the respective integer representation.
- todict()
- Return type:
Dict[str,Any]- Returns:
dictionary form of the
_ThermoAnalysisinstance
- class primer3.thermoanalysis.ThermoResult
Class that wraps the
thal_resultsstruct from libprimer3 to expose tm, dg, dh, and ds values that result from acalc_hairpin(),calc_homodimer(),calc_heterodimer(), orcalc_end_stability()calculation.- ascii_structure_lines
ASCII structure representation split into individual lines
e.g.:
[ 'SEQ - T CCT- A TTGCTTTGAAACAATTCACCATGCAGA', 'SEQ TGC GATG G GCT TGC ', 'STR ACG CTAC C CGA ACG ', 'STR AACCTT T T TTAT G TAGGCGAGCCACCAGCGGCATAGTAA-', ]
- check_exc()
Check the
.msgattribute of the internal thalres struct and raise aRuntimeErrorexception if it is not an empty string. Otherwise, return a reference to the current object.- Raises:
RuntimeError – Message of internal C error
- Return type:
- dg
delta G (Gibbs free energy) of the structure (cal/mol)
- dh
delta H (entropy) of the structure (cal/mol)
- ds
delta S (enthalpy) of the structure (cal/K*mol)
- structure_found
Whether or not a structure (hairpin, dimer, etc) was found as a result of the calculation.
- tm
Melting temperature of the structure in deg. C
- todict(pts=None)
- Parameters:
pts – precision to round floats to
- Return type:
Dict[str,Any]- Returns:
dictionary form of the
ThermoResult
- primer3.thermoanalysis.get_libprimer3_version()
Get the version of the underlying libprimer3 C library.
- Returns:
The version string of libprimer3
- Return type:
str